Journal: Blood Advances

Article Title: SOX11 modulates BCR signaling through the PAX5/CD19 axis for therapeutic targeting in BTK-resistant mantle cell lymphoma

doi: 10.1182/bloodadvances.2025016801

Figure Lengend Snippet: Genetic depletion of SOX11 reduced the expression of PAX5 and CD19. (A) CRISPR/Cas9- and short hairpin RNA (shRNA)-mediated knockdown of SOX11 resulted in reduced protein levels of PAX5 and CD19 in JeKo-1 and Z-138 cells. SCR refers to the scramble control; sg_SOX11 indicates guide RNAs C1 and C2; sh_SOX11 represents shRNA constructs C1 and C2, respectively. (B) Genetic knockdown of SOX11 led to reduced phosphorylation of downstream BCR signaling components. SOX11-deficient cells were stimulated with 5 μg/mL of IgM for 10 minutes, followed by immunoblot analysis of whole-cell lysates. (C) Overexpression of SOX11, tagged with 3XFlag, induces elevated levels of PAX5 and CD19 expression in the MAVER-1 and JeKo-1 cell lines. (D) Ectopic expression of SOX11 resulted in an increased level of PAX5 and CD19 in the SOX11-negative cell line JVM-2. Immunoblot experiments were performed to validate the results, and β-actin was used as a loading control to ensure equivalent loading and transfer. SCR, scramble control; sg_SOX11, guide RNAs C1 and C2; sh_SOX11, shRNA constructs C1 and C2.

Article Snippet: CRISPRevolution synthetic guide RNAs targeting SOX11 (sequence: CCGGGAGGCGCUGGACACGG) and negative control scrambled synthetic guide RNA were procured from Synthego.

Techniques: Expressing, CRISPR, shRNA, Knockdown, Control, Construct, Phospho-proteomics, Western Blot, Over Expression

Journal: Frontiers in Cell and Developmental Biology

Article Title: PPP1R12B inhibits cell proliferation by inducing G0/G1 phase arrest via PAK2/β-catenin axis in hepatocellular carcinoma

doi: 10.3389/fcell.2025.1621705

Figure Lengend Snippet: Clinical significance of PPP1R12B expression in HCC. (A) Comparative analysis of PPP1R12B transcript levels (log2 TPM) between HCC specimens (T, n = 100) and normal hepatic tissues (N, n = 97) from TCGA database (P = 1.6 × 10 −34 ). (B) Immunoblot analysis confirming reduced PPP1R12B protein levels in HCC specimens compared to paired adjacent non-tumor tissues ( n = 29). (C) Immunoblot analysis demonstrating differential PPP1R12B protein expression in 29 paired HCC tumors and adjacent non-tumor tissues (P = 1.424 × 10 −5 ). Protein quantification was normalized to β-actin loading controls. (D) Immunohistochemical staining illustrating representative PPP1R12B expression patterns in matched tumor and adjacent non-tumor tissue sections. The scale bar = 100 μm and 25 μm. (E) Tissue microarray (TMA) analysis depicting heterogeneous PPP1R12B immunoreactivity across HCC clinical samples. The scale bar = 300 μm and 100 μm. (F) Kaplan-Meier survival curves demonstrating significantly prolonged overall survival in HCC patients with high PPP1R12B expression ( n = 228, log-rank trend test).

Article Snippet: The lentiviruses of short hairpin RNA (shRNA) targeting PPP1R12B and scramble shRNA (ShCtrl) were obtained (Genechem Co.), and transfected into PLC/PRF/5, CSQT-2 and HHL5 cell lines according to the manufacturer’s instructions.

Techniques: Expressing, Western Blot, Immunohistochemical staining, Staining, Microarray

Journal: Frontiers in Cell and Developmental Biology

Article Title: PPP1R12B inhibits cell proliferation by inducing G0/G1 phase arrest via PAK2/β-catenin axis in hepatocellular carcinoma

doi: 10.3389/fcell.2025.1621705

Figure Lengend Snippet: Prognostic significance of PPP1R12B in HCC patients. (A) Multivariate Cox regression analysis incorporating TNM staging identified tumor size (HR = 1.086, 95% CI 1.038–1.135, P = 0.000315) and vascular invasion (HR = 1.779, 95% CI 1.118–2.831, p = 0.015) as independent risk factors, while PPP1R12B expression (HR = 0.631, 95% CI 0.411–0.968, p = 0.035) demonstrated protective effects. (B) Alternative multivariate model excluding TNM staging confirmed PPP1R12B’s persistent protective role (HR = 0.601, 95% CI 0.393–0.918, p = 0.018), with tumor size (HR = 1.083, 95% CI 1.037–1.132, p = 0.000331), lymph node metastasis (HR = 4.455, 95% CI 1.603–12.378, p = 0.004), and distant metastasis (HR = 1.761, 95% CI 1.114–2.783, p = 0.015) emerging as additional risk factors. Both models were constructed using forward stepwise regression with AIC-based variable selection.

Article Snippet: The lentiviruses of short hairpin RNA (shRNA) targeting PPP1R12B and scramble shRNA (ShCtrl) were obtained (Genechem Co.), and transfected into PLC/PRF/5, CSQT-2 and HHL5 cell lines according to the manufacturer’s instructions.

Techniques: Expressing, Construct, Selection

Journal: Frontiers in Cell and Developmental Biology

Article Title: PPP1R12B inhibits cell proliferation by inducing G0/G1 phase arrest via PAK2/β-catenin axis in hepatocellular carcinoma

doi: 10.3389/fcell.2025.1621705

Figure Lengend Snippet: PPP1R12B inhibits HCC cell proliferation in vivo and in vitro . (A) Cell viability analysis demonstrating enhanced proliferation in PPP1R12B-knockdown HCC cells compared to controls (HHL5-P = 0.0077, PLC/PRF/5-P = 7.55 × 10 −6 , CSQT-2-P = 0.0001). (B) Clonogenic survival assays showing increased colony formation capacity following PPP1R12B depletion. Quantitative data represent mean colony counts from three independent experiments (±SEM) (HHL5-P = 0.0005, PLC/PRF/5-P = 0.0384, CSQT-2-P = 0.0018). (C) Cell viability analysis revealing significant proliferation inhibition in PPP1R12B-overexpressing HCC cells versus vector controls (Huh7-P = 1.28 × 10 −5 , HepG2-P = 0.0005, MHCC-97H-P = 0.0376). (D) Representative images and quantification of colony formation assays demonstrating reduced proliferative capacity in PPP1R12B-overexpressing cells (mean ± SEM) (Huh7-P = 1.04 × 10 −7 , HepG2-P = 0.0062, MHCC-97H-P = 3.17 × 10 −6 ). (E) Comparative tumor weights from xenograft models at endpoint, showing significant reduction in PPP1R12B-overexpressing Huh7 cell-derived tumors versus controls (P = 0.0086). (F) Longitudinal tumor growth kinetics in nude mice implanted with PPP1R12B-modified Huh7 cells. Data points represent mean tumor volumes (±SEM) measured every 3 days (P = 0.0093).

Article Snippet: The lentiviruses of short hairpin RNA (shRNA) targeting PPP1R12B and scramble shRNA (ShCtrl) were obtained (Genechem Co.), and transfected into PLC/PRF/5, CSQT-2 and HHL5 cell lines according to the manufacturer’s instructions.

Techniques: In Vivo, In Vitro, Knockdown, Inhibition, Plasmid Preparation, Derivative Assay, Modification

Journal: Frontiers in Cell and Developmental Biology

Article Title: PPP1R12B inhibits cell proliferation by inducing G0/G1 phase arrest via PAK2/β-catenin axis in hepatocellular carcinoma

doi: 10.3389/fcell.2025.1621705

Figure Lengend Snippet: PPP1R12B induces cell cycle arrest at the G0/G1 to S phase. (A) Flow cytometric analysis of cell cycle distribution in HHL5 cells following PPP1R12B knockdown, demonstrating a significant decrease in G0/G1 phase population (50.2% vs. 46.6% in controls, P = 0.0079) and concomitant increase in S phase cells (30.0% vs. 31.6%, P = 0.0454). (B) Flow cytometric analysis of cell cycle distribution in HHL5 cells and PLC/PRF/5 cells following PPP1R12B knockdown, demonstrating a significant decrease in G0/G1 phase population (69.4% vs. 63.1% in controls, P = 0.0003) and concomitant increase in S phase cells (17.8% vs. 23.7%, P = 0.0004). (C) Cell cycle profiling of MHCC-97H cells overexpressing PPP1R12B revealed G0/G1 phase arrest (43.3% vs. 46.2% in vector controls, P = 0.0005) with reduced S phase entry (35.2% vs. 32.9%, P = 0.0032). Data represent mean percentages (±SEM) from three independent experiments.

Article Snippet: The lentiviruses of short hairpin RNA (shRNA) targeting PPP1R12B and scramble shRNA (ShCtrl) were obtained (Genechem Co.), and transfected into PLC/PRF/5, CSQT-2 and HHL5 cell lines according to the manufacturer’s instructions.

Techniques: Knockdown, Plasmid Preparation

Journal: Frontiers in Cell and Developmental Biology

Article Title: PPP1R12B inhibits cell proliferation by inducing G0/G1 phase arrest via PAK2/β-catenin axis in hepatocellular carcinoma

doi: 10.3389/fcell.2025.1621705

Figure Lengend Snippet: PAK2 plays a key role in PPP1R12B-mediated HCC proliferation suppression. (A) Schematic overview of the phosphoproteomic profiling strategy comparing PPP1R12B-overexpressing Huh7 cells with vector controls. The workflow includes protein extraction, tryptic digestion, phosphopeptide enrichment, LC-MS/MS analysis, and database search. (B) Protein interaction network of differentially phosphorylated proteins, with PPP1R12B positioned as a central node. The network was constructed using STRING with a confidence score threshold of 0.7. (C) Co-immunoprecipitation analysis demonstrating physical interaction between PPP1R12B and PAK2. Left: Flag-tagged PPP1R12B immunoprecipitated endogenous PAK2 in both Huh7 and HepG2 overexpression cells. Right: Reciprocal co-IP confirmed the interaction using PAK2 antibody for pulldown. (D) Immunofluorescence microscopy revealing subcellular co-localization of PPP1R12B (green) and PAK2 (red) in HCC cells. Nuclei were counterstained with DAPI (blue). Scale bars: 50 μm. (E) Functional rescue experiments showing that PAK2 knockdown (siPAK2) abrogated the proliferative effects of PPP1R12B modulation in CCK-8 assays.

Article Snippet: The lentiviruses of short hairpin RNA (shRNA) targeting PPP1R12B and scramble shRNA (ShCtrl) were obtained (Genechem Co.), and transfected into PLC/PRF/5, CSQT-2 and HHL5 cell lines according to the manufacturer’s instructions.

Techniques: Plasmid Preparation, Protein Extraction, Phospho-proteomics, Liquid Chromatography with Mass Spectroscopy, Construct, Immunoprecipitation, Over Expression, Co-Immunoprecipitation Assay, Immunofluorescence, Microscopy, Functional Assay, Knockdown, CCK-8 Assay

Journal: Frontiers in Cell and Developmental Biology

Article Title: PPP1R12B inhibits cell proliferation by inducing G0/G1 phase arrest via PAK2/β-catenin axis in hepatocellular carcinoma

doi: 10.3389/fcell.2025.1621705

Figure Lengend Snippet: PPP1R12B suppresses proliferation via the PAK2/β-catenin/Cyclin D1 axis. (A) Confocal microscopy analysis demonstrating reduced β-catenin expression (green) following PAK2 (red) knockdown in Huh7 and HepG2 cells. Nuclei were counterstained with DAPI (blue). Scale bars: 50 μm. (B) PAK2-knockdown reduced total β-catenin, p-β-catenin (Ser675), and the expression of Cyclin D1 in CSQT-2 and HHL5 cells. (C) PPP1R12B overexpression decreased while knockdown increased the expression of PAK2, β-catenin, p-β-catenin (Ser675) and Cyclin D1 in HepG2 overexpression cells and CSQT-2 knockdown cells. (D,E) TOPFlash reporter assays measuring β-catenin transcriptional activity: (D) PAK2 knockdown significantly reduced β-catenin-mediated transcription (Huh7-P = 0.0003, HepG2-P = 0.0005); (E) PPP1R12B modulation correspondingly altered β-catenin activity (HepG2-P = 0.0411, CSQT-2-P = 0.0002, HHL5-P = 0.0037). (F) Subcellular fractionation analysis demonstrating PPP1R12B knockdown increased nuclear β-catenin accumulation. GAPDH and Lamin B1 served as compartment-specific controls. (G) CCK-8 assay revealed that palbociclib inhibited HCC cell proliferation and counteracted the proliferative changes induced by PPP1R12B modulation in HepG2 overexpression cells and CSQT-2 knockdown cells. The data were presented as mean ± SEM.

Article Snippet: The lentiviruses of short hairpin RNA (shRNA) targeting PPP1R12B and scramble shRNA (ShCtrl) were obtained (Genechem Co.), and transfected into PLC/PRF/5, CSQT-2 and HHL5 cell lines according to the manufacturer’s instructions.

Techniques: Confocal Microscopy, Expressing, Knockdown, Over Expression, Activity Assay, Fractionation, CCK-8 Assay

Journal: Frontiers in Cell and Developmental Biology

Article Title: PPP1R12B inhibits cell proliferation by inducing G0/G1 phase arrest via PAK2/β-catenin axis in hepatocellular carcinoma

doi: 10.3389/fcell.2025.1621705

Figure Lengend Snippet: Clinical correlation between PPP1R12B and PAK2/β-catenin in HCC patients. (A) Transcriptomic analysis of PAK2 expression across multiple HCC cohorts ( GSE22058 , GSE36376 , GSE14520 , OEP000321) demonstrating significant upregulation in tumor tissues versus adjacent non-tumor controls ( GSE22058 -P = 0.0070, GSE36376 -P = 6.89 × 10 −26 , GSE14520 -P = 9.48 × 10 −39 , OEP000321-P = 4.38 × 10 −18 ). Boxplots represent median values with interquartile ranges. Data presented as log2-transformed TPM values. (B) Comparative analysis of CTNNB1 (β-catenin) mRNA levels showing consistent overexpression in HCC specimens across above datasets ( GSE22058 -P = 1.14 × 10 −8 , GSE36376 -P = 0.0406, GSE14520 -P = 4.77 × 10 −25 , OEP000321-P = 2.90 × 10 −17 ). Boxplots represent median values with interquartile ranges. Data presented as log2-transformed TPM values. (C) Spearman correlation analysis of TCGA-LIHC data revealing significant inverse relationships: PPP1R12B vs. PAK2: r = −0.2417, P = 0.0308; PPP1R12B vs. CTNNB1: r = −0.2489, p = 0.0260.

Article Snippet: The lentiviruses of short hairpin RNA (shRNA) targeting PPP1R12B and scramble shRNA (ShCtrl) were obtained (Genechem Co.), and transfected into PLC/PRF/5, CSQT-2 and HHL5 cell lines according to the manufacturer’s instructions.

Techniques: Expressing, Transformation Assay, Over Expression

Journal: Frontiers in Cell and Developmental Biology

Article Title: PPP1R12B inhibits cell proliferation by inducing G0/G1 phase arrest via PAK2/β-catenin axis in hepatocellular carcinoma

doi: 10.3389/fcell.2025.1621705

Figure Lengend Snippet: Schematic model. PPP1R12B suppresses HCC cell proliferation through the PAK2/β-catenin/Cyclin D1 axis. PPP1R12B could interact with PAK2 to suppress the expression and Ser675 phosphorylation of β-catenin, thereby inhibiting its nuclear translocation and the expression of its downstream target gene CCND1 , which regulated cell proliferation.

Article Snippet: The lentiviruses of short hairpin RNA (shRNA) targeting PPP1R12B and scramble shRNA (ShCtrl) were obtained (Genechem Co.), and transfected into PLC/PRF/5, CSQT-2 and HHL5 cell lines according to the manufacturer’s instructions.

Techniques: Expressing, Phospho-proteomics, Translocation Assay